Skip to Content
Merck
All Photos(1)

Documents

EMU049871

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sox4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACAGAGTGAGGGGAAGAGGGCCGTCTCCCTCCCGGTTTCCAGTTCTTGCACGCTGTTTCTTAGAGAGTCTGCAGTGGGGGAACTCTGCCGGTAACCAGCTCCCCTTCTTGCAGGAGGGAGGGAGAAACATACATTTATTCATGCCGGTCTGTTGCATGCAAGCTTCTTGGCTTCCTACCTTGCAACAAAATAATTGCACCAACTCCTCAGCGCCGATTCCGCCCACAGAGAGTCCCGGAGCCAGAGTCGCTTTGGCTTTGCACTGCAGGAAAGGGACTTAGGCGCTAGAGACGATGTCGCTTTCCTGAGCTACCGCGAGCTCTCGTGAACTGCAATCGACTGCTTCAGGGAAAGGGGTGGGGGAAAGACTTGCCCCGGAGGCGGCGAGAAACTTGCGTTTGGAAGATACTCCGGCTACCAACGTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jie Xi et al.
American journal of cancer research, 7(11), 2180-2189 (2017-12-09)
Ovarian cancer (OC) is one of the most fatal gynecological cancer in women worldwide. Long noncoding RNA (lncRNA) lncBRM was found to be associated with the progression and prognosis of hepatocellular carcinoma (HCC). However, the expression level, clinical significance and
Tae Mi Yoon et al.
BMC cancer, 15, 888-888 (2015-11-12)
In humans, sex-determining region-Y (SRY) related high-mobility-group box 4 (SOX4) is linked to development and tumorigenesis. SOX4 is over-expressed in several cancers and has prognostic significance. This study evaluated whether SOX4 affects oncogenic behavior and chemoradiotherapy response in head and
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service