Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU182711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Clec7a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGCTACTTCCTCAACTAGATAACTCAAAGAGTCTGCCCACCTTTTCTGATAGCAAATCTGGTATCTAGATTTCACTGTTTCCTTATGCTGTCTGGCCAGCAGTATGACAAAGGTGCTGCCCTTTCAGGAAGCAGTCTCCTTAAATGCTGTAGTTGGAAAGATAAATCATATCTGATAGTGAATATTTAAAAAGCGCCCAGTCAGGATAAGTGTTTTGGAACACAGAACATATTTCATCTTTTTATGATACACTATCTTGCAATTAACAACCAATTCTTAAGTCATTTCTTTACAAACATATGACTGGAATATGACTGTTTCCTAGTGTGATCTGTCTTGTTAACTTCTAAGATTGTCCATTAATACCACCCTTATTTCCAGTGTGGACTTCCAAATTGCTGGGGATCTGTTTATAGCTTTCTCAGACTAATCAATATGTGGGCAGAAATTGTGCTGAGTCCACTGAATTGTTCTCTTGAAAATGATTGGGTTTATGTCACTTTCATC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marije Oosting et al.
Cytokine, 76(2), 465-472 (2015-08-25)
Although it is known that Borrelia species express sugar-like structures on their outer surface, not much is known about the role of these structures in immune recognition by host cells. Fungi, like Candida albicans, are mainly recognized by C-type lectin
Yi Sak Kim et al.
Journal of microbiology (Seoul, Korea), 53(12), 864-874 (2015-12-03)
Mycobacterium chelonae (Mch) is an atypical rapidly growing mycobacterium (RGM) that belongs to the M. chelonae complex, which can cause a variety of human infections. During this type of mycobacterial infection, macrophage-derived chemokines play an important role in the mediation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico