Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU081311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plxnb2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCCCTGTATGTGGGCAGTGAGCTGCTGAATTTTGAAGAGACTGTGACCATGCATGAATCAGACACCTTCTCTTTTAGGACCCCAAAGCTATCCCATGATGGTAATGAGACACTGCCTCTTCACCTGTATGTTAAGTCCTTTGGCAAGAACATTGACAGCAAGCTACAAGTGACTCTCTACAACTGCTCCTTTGGCCGCAGTGACTGTAGCCTGTGTCTGGCTGCCGATCCTGCCTACAGGTGTGTGTGGTGCCGTGGGCAGAACCGGTGCGTGTACGAAGCTCTGTGCAGCAATGTCACTTCTGAGTGCCCACCACCAGTTATCACTAGGATCCAGCCTGAGACGGGCCCGCTGGGTGGGGGCATCCTGGTCACTATCCATGGGTCCAATCTGGGTGTCAAAGCAGATGACGTCAAGAAGATAACTGTGGCTGGCCAGAACTGTGCCTTTGAACCAAGAGGGTACTCCG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico