Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU071391

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Abl1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCTTGAAGGAGGACACCATGGAGGTGGAGGAGTTCCTGAAGGAAGCGGCGGTGATGAAGGAGATCAAACACCCTAACCTGGTGCAGCTGCTAGGGGTGTGTACCCGGGAACCACCATTCTACATAATCACTGAGTTCATGACCTATGGGAACCTGCTGGACTACCTGAGGGAGTGTAACCGGCAGGAGGTGAGCGCCGTGGTACTGCTCTACATGGCCACACAGATCTCATCAGCCATGGAGTACTTGGAGAAGAAGAACTTCATCCACAGAGACCTTGCTGCCCGGAACTGCCTGGTAGGGGAAAACCACTTGGTGAAGGTGGCTGATTTTGGCCTGAGCAGGTTGATGACAGGGGACACCTACACGGCCCATGCTGGAGCCAAATTCCCCATCAAATGGACCGCACCTGAGAGCCTGGCCTACAAC

Ensembl | nº de acceso | ratón

ENSMUSG00000026842

Nº de acceso NCBI

NM_009594

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ABL1(11350) , Abl1(11350)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carolin F Manthey et al.
American journal of physiology. Cell physiology, 307(2), C180-C189 (2014-05-23)
Enteropathogenic Escherichia coli (EPEC) and Citrobacter rodentium are attaching-and-effacing (A/E) pathogens that cause intestinal inflammation and diarrhea. The bacteria adhere to the intestinal epithelium, destroy microvilli, and induce actin-filled membranous pedestals but do not invade the mucosa. Adherence leads to
Zannel Blanchard et al.
PloS one, 9(4), e95663-e95663 (2014-05-03)
Breast cancer is the second leading cause of cancer-related deaths in women. Triple negative breast cancer (TNBC) is an aggressive subtype that affects 10-25% mostly African American women. TNBC has the poorest prognosis of all subtypes with rapid progression leading

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico