Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU063601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ntn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACTGCCACTACTGCAAGGAGGGCTTCTACCGAGACATGGGCAAGCCTATCACCCACCGGAAGGCTTGCAAAGCCTGTGATTGCCACCCAGTGGGTGCTGCTGGCAAGACCTGCAATCAAACCACTGGCCAATGTCCCTGCAAGGACGGCGTGACGGGCATCACCTGCAACCGATGTGCCAAAGGCTACCAGCAGAGCCGTTCCCCCATCGCCCCTTGCATCAAGATTCCTGTGGCGCCGCCCACCACTGCAGCCAGCAGCGTGGAGGAACCGGAAGACTGTGATTCCTATTGCAAGGCCTCCAAAGGCAAGCTGAAGATGAACATGAAGAAATACTGCAGGAAGGACTATGCTGTCCAGATCCACATCCTGAAGGCCGACAAAGCAGGGGACTGGTGGAAGTTCACCGT

Ensembl | nº de acceso | ratón

ENSMUSG00000020902

Nº de acceso NCBI

NP_032770

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NTN1(18208) , Ntn1(18208)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ping Han et al.
American journal of cancer research, 5(4), 1396-1409 (2015-06-24)
The axon guidance cues netrin-1 has been reported to be associated with cancer progression in various types of human cancers. However, the underlying molecular mechanism of netrin-1-mediated metastasis remains obscure. In this study, we found that overexpression of netrin-1 promoted
Punithavathi Ranganathan et al.
Journal of cellular and molecular medicine, 18(7), 1290-1299 (2014-04-12)
The netrin-1 administration or overexpression is known to protect colon from acute colitis. However, the receptor that mediates netrin-1 protective activities in the colon during colitis remains unknown. We tested the hypothesis that UNC5B receptor is a critical mediator of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico