Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU050341

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sesn2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAGCCTGCAGCCTCACCTATAACACCATCGCCATGCACAGTGGCGTGGACACCTCCATGCTCCGCAGGGCCATCTGGAACTACATCCACTGCGTCTTTGGCATCAGATACGATGACTATGATTACGGCGAGGTAAACCAGCTCCTGGAACGGAACCTCAAAATCTATATCAAGACGGTGGCCTGCTACCCTGAGAAGACGACCCGTAGGATGTACAACCTCTTTTGGAGGCACTTCCGCCACTCAGAGAAGGTTCATGTGAACTTGCTGCTCCTTGAAGCCCGCATGCAAGCGGCCCTGCTCTATGCCCTGCGCGCCATCACCCGCTACATGACCTGACTACCCCGTACGCAGGACCAGCACCAGGAGCAGCTGACCCTGGTCCACCGTCCTCTGTGCAAGGACTTCTGTGTCTGGAGACAGATCTGGGAAGG

Ensembl | nº de acceso | ratón

ENSMUSG00000028893

Nº de acceso NCBI

NM_144907

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SESN2(230784) , Sesn2(230784)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hiroko Hamatani et al.
American journal of physiology. Renal physiology, 307(6), F708-F717 (2014-07-25)
Sestrin 2, initially identified as a p53 target protein, accumulates in cells exposed to stress and inhibits mammalian target of rapamycin (mTOR) signaling. In normal rat kidneys, sestrin 2 was selectively expressed in parietal epithelial cells (PECs), identified by the
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico