Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU049871

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sox4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAACAGAGTGAGGGGAAGAGGGCCGTCTCCCTCCCGGTTTCCAGTTCTTGCACGCTGTTTCTTAGAGAGTCTGCAGTGGGGGAACTCTGCCGGTAACCAGCTCCCCTTCTTGCAGGAGGGAGGGAGAAACATACATTTATTCATGCCGGTCTGTTGCATGCAAGCTTCTTGGCTTCCTACCTTGCAACAAAATAATTGCACCAACTCCTCAGCGCCGATTCCGCCCACAGAGAGTCCCGGAGCCAGAGTCGCTTTGGCTTTGCACTGCAGGAAAGGGACTTAGGCGCTAGAGACGATGTCGCTTTCCTGAGCTACCGCGAGCTCTCGTGAACTGCAATCGACTGCTTCAGGGAAAGGGGTGGGGGAAAGACTTGCCCCGGAGGCGGCGAGAAACTTGCGTTTGGAAGATACTCCGGCTACCAACGTTT

Ensembl | nº de acceso | ratón

ENSMUSG00000076431

Nº de acceso NCBI

NM_009238

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SOX4(20677) , Sox4(20677)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Xi et al.
American journal of cancer research, 7(11), 2180-2189 (2017-12-09)
Ovarian cancer (OC) is one of the most fatal gynecological cancer in women worldwide. Long noncoding RNA (lncRNA) lncBRM was found to be associated with the progression and prognosis of hepatocellular carcinoma (HCC). However, the expression level, clinical significance and
Tae Mi Yoon et al.
BMC cancer, 15, 888-888 (2015-11-12)
In humans, sex-determining region-Y (SRY) related high-mobility-group box 4 (SOX4) is linked to development and tumorigenesis. SOX4 is over-expressed in several cancers and has prognostic significance. This study evaluated whether SOX4 affects oncogenic behavior and chemoradiotherapy response in head and
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico