Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU040051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hsf1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGTCAAGCCTGAGAGAGATGACACCGAGTTCCAGCATCCTTGTTTCTTGCGTGGACAGGAACAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGCGTGTCCACCCTGAAGAGTGAGGACATAAAAATACGCCAGGACAGTGTCACCCGGCTGTTGACAGATGTGCAGCTGATGAAGGGGAAACAGGAGTGTATGGACTCCAAGCTCCTGGCCATGAAGCACGAGAACGAGGCCCTGTGGCGGGAGGTGGCCAGCCTTCGGCAGAAGCATGCCCAGCAGCAAAAAGTTGTCAACAAGCTCATTCAGTTCCTGATCTCACTGGTGCAGTCGAACCGGATCCTGGGGGTGAAGAGAAAGATCCCTCTGATGTTGAGTGACAGCAACTCAGCACACTCTGTGCCCAAGTATGGTCGACAGTACTCCCTGGAGCATGTCCATGGTCCTGGCCCATACTCAGCTCCATCTCCAGCCTACAGCAGCTCTAGCCTTTACTCCTCTGATGCTGTCACCA

Ensembl | nº de acceso | ratón

ENSMUSG00000022556

Nº de acceso NCBI

NM_008296

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... HSF1(15499) , Hsf1(15499)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX
Bin Wang et al.
Breast cancer research and treatment, 153(1), 57-66 (2015-08-01)
Heat shock factor 1 (HSF1) has long been recognized as the master transcription factor that regulates heat shock proteins (HSPs).  More recently HSF1 has been associated with a broader role in regulating response to a variety of cellular stresses beyond

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico