Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU011161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gpnmb

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGCCAGCATCTCAGGTTCCCGGACAGGAGGCCCTTCCCTCGCCCCCATGGATGGAAGAAATGGAGCTTTGTCTACGTCTTTCACACACTTGGCCAGTATTTCCAAAAACTGGGTCGGTGTTCAGCACGGGTTTCTATAAACACAGTCAACTTGACAGCTGGCCCTCAGGTCATGGAAGTGACTGTCTTTCGAAGATACGGCCGGGCATACATTCCCATCTCGAAGGTGAAAGATGTGTATGTGATAACAGATCAGATCCCTGTATTCGTGACCATGTCCCAGAAGAATGACAGGAACTTGTCTGATGAGATCTTCCTCAGAGACCTCCCCATCGTCTTCGATGTCCTCATTCATGATCCCAGCCACTTCCTCAACGACTCTGCCATTTCCTACAAGTGGAACTTTGGGGACAACACTGG

Ensembl | nº de acceso | ratón

ENSMUSG00000029816

Nº de acceso NCBI

NM_053110

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... GPNMB(93695) , Gpnmb(93695)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Yu-Liang Wang et al.
International journal of clinical and experimental pathology, 8(6), 6498-6504 (2015-08-12)
Glycoprotein (transmembrane) nonmetastatic melanoma protein b (GPNMB) plays crucial roles in odontogenesis. However, the role of GPNMB in human dental pulp cells (hDPCs) is still unclear. Therefore, in this study, we investigated the expression and function of the GPNMB in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico