Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU157831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGCGTTCTGTCATCTCAGCAAAGAATGGAATCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGACCAGTGTTACTTTTGGAACCCCAGAGCGCCGCAAAGGGAGTCTTGCCGATGTGGTGGACACACTGAAACAGAAGAAGCTTGAGGAAATGACTCGGACTGAACAAGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACCAGTGAACTTCTTGGAGAAATTAAAGGTACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACCATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTACTGG

Ensembl | nº de acceso humano

ENSG00000110693

Nº de acceso NCBI

NM_001145819

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SOX6(55553) , SOX6(55553)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shifeng Long et al.
Experimental and therapeutic medicine, 17(6), 4741-4747 (2019-05-21)
Increasing evidence has revealed that microRNAs (miRNAs) are closely associated with multiple myeloma (MM) pathogenesis and progression. Therefore, an in-depth understanding of the biological functions of miRNAs in MM may be helpful for the identification of promising therapeutic techniques for
W-W Xu et al.
European review for medical and pharmacological sciences, 24(8), 4070-4079 (2020-05-07)
Fragile fracture patients need to be treated with long-term fixation and the recovery process is slow. Several studies have shown that the fracture healing process is related to gene expression. We aimed to investigate the role of long chain non-coding
Aruna Marchetto et al.
Nature communications, 11(1), 2423-2423 (2020-05-18)
Ewing sarcoma (EwS) is an aggressive childhood cancer likely originating from mesenchymal stem cells or osteo-chondrogenic progenitors. It is characterized by fusion oncoproteins involving EWSR1 and variable members of the ETS-family of transcription factors (in 85% FLI1). EWSR1-FLI1 can induce

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico