Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU138481

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATGTTCGACCTGAGCTTGAATTTCTCTCAAAGCGCGCACAGCGCCAGCGAGCAGCAGCTGGGGGGCGGCGCGGCGGCCGGGAACCTGTCCCTGTCGCTGGTGGATAAGGATTTGGATTCGTTCAGCGAGGGCAGCCTGGGCTCCCACTTCGAGTTCCCCGACTACTGCACGCCGGAGCTGAGCGAGATGATCGCGGGGGACTGGCTGGAGGCGAACTTCTCCGACCTGGTGTTCACATATTGAAAGGCGCCCGCTGCTCGCTCTTTCTCTCGGAGGGTGCAGAGCTGGGTTCCTTGGGAGGAAGTTGTAGTGGTGATGATGATGATGATAATGATGATGATGATGGTGGTGTTGATGGTGGCGGTGGTAGGGTGGAGGGGAGAGAAGAAGATGCTGATGATATTGATAAGATGTCGTGACGCAAAGAAA

Ensembl | nº de acceso humano

ENSG00000176887

Nº de acceso NCBI

NM_003108

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SOX11(6664) , SOX11(6664)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lei Chang et al.
American journal of cancer research, 7(11), 2305-2317 (2017-12-09)
To explore the functions of
Feng Xue et al.
Oncology letters, 21(4), 255-255 (2021-03-06)
The dysregulation of lncRNA TMPO antisense RNA 1 (TMPO-AS1) has been detected in various malignant tumors. However, the role of lncRNA TMPO-AS1 remains unclear in pancreatic carcinoma. The present study aimed to elucidate the functional mechanism of TMPO-AS1 in pancreatic
Mingxing Fang et al.
International journal of molecular medicine, 47(1), 361-373 (2020-11-26)
The aim of the present study was to explore the potential role of SOX11 in the stretch‑induced mechanical injury to alveolar type 2 epithelial (AT2) cells. A cell stretch (CS) test was used to induce mechanical injury to primary cultured AT2 cells. Wound
Atish Mohanty et al.
Blood, 133(4), 306-318 (2018-12-12)
The neural transcription factor SOX11 is usually highly expressed in typical mantle cell lymphoma (MCL), but it is absent in the more indolent form of MCL. Despite being an important diagnostic marker for this hard-to-treat malignancy, the mechanisms of aberrant
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico