Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU137921

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Ensembl | nº de acceso humano

ENSG00000140575

Nº de acceso NCBI

NM_003870

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IQGAP1(8826) , IQGAP1(8826)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Niramol Jitprasutwit et al.
Journal of proteome research, 15(12), 4675-4685 (2016-12-10)
Intracellular actin-based motility of the melioidosis pathogen Burkholderia pseudomallei requires the bacterial factor BimA. Located at one pole of the bacterium, BimA recruits and polymerizes cellular actin to promote bacterial motility within and between cells. Here, we describe an affinity
Aaron M Tocker et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2896-2909 (2017-09-03)
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers
Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Shihong Su et al.
DNA and cell biology, 39(7), 1127-1140 (2020-05-05)
Pulmonary microvascular endothelium barrier plays a critical role in protecting the pulmonary tissue from inflammatory injury in acute respiratory distress syndrome and acute lung injury (ARDS/ALI). The dysregulation of IQ-GTPase-activating protein 1 (IQGAP1) was an important etiology of endothelium barrier
Ana C Alcalá et al.
The Journal of general virology, 98(8), 2088-2099 (2017-08-02)
Dengue virus NS1 is a glycoprotein of 46-50 kDa that is conserved among flaviviruses, associates as a dimer to cell membranes and is secreted as a hexamer to the extracellular milieu. Recent evidence showed that NS1 is secreted efficiently from infected
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico