Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU134841

Sigma-Aldrich

MISSION® esiRNA

targeting human OS9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAACCTGGAGGAGCTGAGTGAGATGCGTTATGGGATCGAGATCCTGCCGTTGCCTGTCATGGGAGGGCAGAGCCAATCTTCGGACGTGGTGATTGTCTCCTCTAAGTACAAACAGCGCTATGAGTGTCGCCTGCCAGCTGGAGCTATTCACTTCCAGCGTGAAAGGGAGGAGGAAACACCTGCTTACCAAGGGCCTGGGATCCCTGAGTTGTTGAGCCCAATGAGAGATGCTCCCTGCTTGCTGAAGACAAAGGACTGGTGGACATATGAATTCTGTTATGGACGCCACATCCAGCAATACCACATGGAAGATTCAGAGATCAAAGGTGAAGTCCTCTATCTCGGCTACTACCAATCAGCCTTCGACTGGGATGATGAAACAGCCAAGGCCTCCAAGCAGCATCGTCTTAAACGCTACCACAGCCAGAC

Ensembl | nº de acceso humano

ENSG00000135506

Nº de acceso NCBI

NM_001017956

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... OS9(10956) , OS9(10956)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bryan K Ward et al.
Journal of cellular physiology, 233(1), 38-56 (2017-04-19)
The mechanisms responsible for the processing and quality control of the calcium-sensing receptor (CaSR) in the endoplasmic reticulum (ER) are largely unknown. In a yeast two-hybrid screen of the CaSR C-terminal tail (residues 865-1078), we identified osteosarcoma-9 (OS-9) protein as
Marioara Chiritoiu et al.
International journal of molecular sciences, 21(10) (2020-05-20)
Endoplasmic reticulum (ER)-associated degradation (ERAD) is the main mechanism of targeting ER proteins for degradation to maintain homeostasis, and perturbations of ERAD lead to pathological conditions. ER-degradation enhancing α-mannosidase-like (EDEM1) was proposed to extract terminally misfolded proteins from the calnexin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico