Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU134631

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1H3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAG

Ensembl | nº de acceso humano

ENSG00000025434

Nº de acceso NCBI

NM_001130101

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NR1H3(10062) , NR1H3(10062)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Akihiro Shimada et al.
Lipids in health and disease, 15, 57-57 (2016-03-18)
Statins decrease cholesteryl ester transfer protein (CETP) levels, which have been positively associated with hepatic lipid content as well as serum low density lipoproteins-cholesterol (LDL-C) levels. However, the relationship between the CETP status and statin-induced reductions in LDL-C levels has
Claudia Bellomo et al.
Cell death and differentiation, 25(5), 885-903 (2017-12-13)
Understanding the complexity of changes in differentiation and cell survival in hepatocellular carcinoma (HCC) is essential for the design of new diagnostic tools and therapeutic modalities. In this context, we have analyzed the crosstalk between transforming growth factor β (TGFβ)
Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Louise Ménégaut et al.
Cell reports, 31(7), 107665-107665 (2020-05-21)
Low-grade inflammation is constitutive of atherosclerosis, and anti-inflammatory therapy inhibiting interleukin-1β (IL-1β) reduces the rate of cardiovascular events. While cholesterol accumulation in atheroma plaque and macrophages is a major driver of the inflammatory process, the role of the LXR cholesterol
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico