Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU132901

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTCAGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGGGGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTT

Ensembl | nº de acceso humano

ENSG00000077463

Nº de acceso NCBI

NM_016539

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SIRT6(51548) , SIRT6(51548)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming-Yue Cheng et al.
American journal of translational research, 8(11), 5005-5015 (2016-12-03)
The present study explored changes of the SIRT6/NF-κB pathway in myocardial hypoxia/reoxygenation induced injury and the effects on mitochondrial damage and myocardial damage by regulating SIRT6. SIRT6 expression decreased and NF-κB expression increased in H9c2 cells during hypoxic injury. Cell
Ganye Zhao et al.
Aging, 8(10), 2308-2323 (2016-10-31)
Sirtuin6(SIRT6) has been implicated as a key factor in aging and aging-related diseases. However, the role of SIRT6 in cellular senescence has not been fully understood. Here, we show that SIRT6 repressed the expression of p27Kip1 (p27) in cellular senescence.
Ning Qu et al.
International journal of oncology, 50(5), 1683-1692 (2017-04-11)
Sirtuin 6 (SIRT6) is a member of the SIRT family NAD+‑dependent deacetylases reported to function in controlling organism homeostasis, lifespan, and diseases. This study investigated the role of SIRT6 in papillary thyroid cancer (PTC). Data of 391 PTC patients was extracted
Yujuan Yang et al.
European journal of pharmacology, 859, 172516-172516 (2019-07-03)
Angiotensin II (Ang II) is a vasoactive peptide that elevates arterial blood pressure and leads to hypertension. Ang II has been reported to induce endothelial dysfunction by induction of apoptosis and oxidative stress in vascular endothelial cells. Sirtuin6 (SIRT6) has
Guang-Li Sun et al.
Biochemical and biophysical research communications, 514(3), 777-784 (2019-05-14)
Ultra-violet radiation (UVR) can induce significant oxidative injury to human lens epithelial cells (HLECs). Sirtuin 6 (SIRT6) is shown to directly bind to Nrf2, essential for Nrf2 signaling activation. In the present study, we show that microRNA-4532 (miR-4532) targets SIRT6
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico