Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU105041

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTGGGTGAAGAATGGAAGGGTTATGTGGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCAGGGTGTCTTGACCCATGGCCGTGTCCGCCTGCTACTGAGTAAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAGAAAGAAAGAGAAAATCAGTTCGTGGTTGCATTGTGGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAAAAAAGGAGAGAAGGATATTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTGGGCCCCAAAAGAGCTAGCAGAATCCGCAAACTTTTCAATCTCTCTAAAGAAGATGATGTCCGCCAGTATGTTGTAAGAAAGCCCTTAAATAAAGAAGGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTGCAG

Ensembl | nº de acceso humano

ENSG00000137154

Nº de acceso NCBI

NM_001010

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RPS6(6194) , RPS6(6194)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yun Zou et al.
Oncotarget, 8(13), 20825-20833 (2017-02-18)
Renal cell carcinoma (RCC) is a urologic malignant cancer and often diagnosed at an advanced stage, which results in high mortality. Targeted therapy may improve the quality of life and survival of patients who are not suitable for nephrectomy. Everolimus
Atsuko Tsukimoto et al.
Antiviral research, 117, 1-9 (2015-02-11)
Previous studies have demonstrated that cyclopentenone prostaglandins (cyPGs) inhibit the replication of a wide variety of DNA and RNA viruses in different mammalian cell types. We investigated a new role for prostaglandin A1 (PGA1) in the inhibition of hepatitis C
Lingqin Yuan et al.
Endocrine-related cancer, 22(4), 577-591 (2015-06-06)
Glutamine is one of the main nutrients used by tumor cells for biosynthesis. Therefore, targeted inhibition of glutamine metabolism may have anti-tumorigenic implications. In the present study, we aimed to evaluate the effects of glutamine on ovarian cancer cell growth.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico