Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU097001

Sigma-Aldrich

MISSION® esiRNA

targeting human DMBT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCTTACTACGTGGACCTGAACCAGGACTTGTACGTTCAGGCTGAAATCCTCCATTCTGATGCTGTACTGACCTTGTTTGTGGACACCTGCGTGGCATCACCATACTCCAATGACTTCACGTCTTTGACTTATGATCTAATCCGGAGTGGATGCGTGAGGGATGACACCTACGGACCCTACTCCTCGCCATCTCTTCGCATTGCCCGCTTCCGGTTCAGGGCCTTCCACTTCCTGAACCGCTTCCCCTCCGTGTACCTGCGTTGTAAAATGGTGGTGTGCAGAGCGTATGACCCCTCTTCCCGCTGCTACCGAGGCTGTGTGTTGAG

Ensembl | nº de acceso humano

ENSG00000187908

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DMBT1(1755) , DMBT1(1755)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Liang et al.
Nature communications, 10(1), 4579-4579 (2019-10-09)
Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by progressive bone erosion. Leflunomide is originally developed to suppress inflammation via its metabolite A77 1726 to attenuate bone erosion. However, distinctive responsiveness to Leflunomide is observed among RA individuals. Here
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico