Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU092251

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF4G

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTCTCGCCAGATCTCAGTCTCAAGCCCTGGGTCAAGCACTGACATAAACGTTAAGAAAATTGCAAGTATTGGTGATGTCTGTGAATCTATGAAACAGCAGCTCTTAGTCTTGGTGGAATGGGCTAAATATATTCCTGCCTTCTGTGAATTACCATTGGATGATCAGGTGGCACTGTTGAGAGCTCACGCAGGGGAGCACTTACTGCTTGGAGCTACAAAGAGATCCATGATGTATAAAGATATTTTGCTTTTGGGAAACAACTATGTTATTCACCGCAACAGCTGTGAAGTTGAGATTAGCCGTGTGGCCAATCGTGTTCTAGATGAGCTGGTTAGACCATTTCAAGAAATCCAGATTGATGACAATGAGTATGCTTGTTTAAAGGCAATTGTATTTTTTGATCCAGATGCAAAAGGGCTAAGC

Ensembl | nº de acceso humano

ENSG00000164749

Nº de acceso NCBI

NM_004133

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HNF4G(3174) , HNF4G(3174)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Daliang Kong et al.
Journal of cellular biochemistry, 119(1), 1050-1061 (2017-07-09)
Osteosarcoma is a rare malignant bone tumor with high degree of malignancy. HULC (highly upregulated in liver cancer), a long noncoding RNA (lncRNA) was involved in hepatocellular carcinoma development and progression, but its underlying mechanism in osteosarcoma is unknown. The
Huaibin Sun et al.
Disease markers, 2015, 879254-879254 (2015-04-17)
miR-34a is a member of the miR-34 family and acts as a tumor suppressor in bladder cancer. This study explored the regulative role of miR-34a on an orphan nuclear receptor HNF4G, which has a well-confirmed role in bladder tumor growth

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico