Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU089621

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCATTCCCAGATGGTCTCGTGCACCCCCCGACCTCGGCCGCAGCCCCTGTCACCCCTCTACGGCCCCCTGGCCTGGGCTCTGCCTCCCTGCATGGTGGGGGCCCAGCCCGTCGGAGAAGCAGTGACAAGTTCTGCTCCCCCATCTCCTCAGAGCTGGCCCAGAATCATGAGTTCTACAAGAACGCCGACGTCCGGCCCCCCTTCACCTACGCCTCCCTCATCCGCCAGGCCATCCTGGAAACCCCTGACAGGCAGCTGACCCTGAATGAGATCTATAACTGGTTCACCAGGATGTTCGCCTATTTCCGCAGAAACACTGCCACCTGGAAGAACGCCGTGCGCCACAACCTCAGCCTGCACAAGTGCTTCGTCCGCGTGGAGAACGTCAAGGGTGCCGTGTGGACTGTGGACGAGCGGGAGTATCAGAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoli Wang et al.
OncoTargets and therapy, 13, 4569-4579 (2020-06-18)
Laryngeal cancer is a common malignant tumor in the ENT, of which laryngeal squamous cell carcinoma (LSCC) accounts for more than 90% of laryngeal cancer. The purpose of this study is to investigate the regulatory mechanism of lncRNA SNHG16 in
Tao Ma et al.
Cancer management and research, 11, 2783-2793 (2019-05-02)
Family of forkhead box transcription factors has been found to play key roles in multiple types of cancer. Our study is to decipher the effects of FOXP4 in human breast cancer (BC). Quantitative real-time polymerase chain reaction and Western blot

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico