Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU089471

Sigma-Aldrich

MISSION® esiRNA

targeting human ANKFY1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTGAGGTGACGATGACAATGCTTCGCTGGATCTATACAGATGAGCTGGAGTTCAGAGAGGATGATGTGTTCCTGACTGAACTGATGAAACTAGCAAATCGGTTTCAGCTACAGCTCCTCAGGGAGAGGCAAAAGGGTGTTATGTCTCTAGTGAATGTCAGGAACTGTATTCGCTTCTACCAGACGGCAGAGGAGCTGAATGCCAGCACACTGATGAACTACTGTGCAGAAATTATTGCAAGTCATTGGGACGACCTGAGGAAGGAGGATTTCAGCAGCATGAGCGCTCAGTTGTTATACAAAATGATCAAATCCAAGACAGAGTACCCGCTACATAAAGCCATCAAAGTGGAGAGAGAAGACGTGGTCTTCCTGTATCTGATTGAAATGGATTCCCAGCTCCCTGGGAAGCTGAATGAAGCGGATC

Ensembl | nº de acceso humano

ENSG00000185722

Nº de acceso NCBI

NM_016376

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ANKFY1(51479) , ANKFY1(51479)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Miruto Tanaka et al.
Biochemical and biophysical research communications, 533(4), 1406-1412 (2020-10-24)
Dysregulation of endothelial cell proliferation and migration are hallmarks of angiogenic diseases. Among them, excessive ocular angiogenesis is a major cause of blindness. Vascular endothelial growth factor (VEGF)-VEGF receptor 2 (VEGFR2) signaling plays crucial roles in angiogenesis, endothelial cell proliferation
Trey Farmer et al.
Journal of cell science, 130(14), 2359-2370 (2017-06-10)
Mitochondria play essential roles in cellular energy processes, including ATP production, control of reactive oxygen species (ROS) and apoptosis. While mitochondrial function is regulated by the dynamics of fusion and fission, mitochondrial homeostasis remains incompletely understood. Recent studies implicate dynamin-2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico