Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU081071

Sigma-Aldrich

MISSION® esiRNA

targeting human DUSP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCCTTCAGCAGTTTCTCTTGGCAGCATCAGCTGGGCTGCTTTCTTTGTGTGTGGCCCCAGGTGTCAAAATGACACCAGCTGTCTGTACTAGACAAGGTTACCAAGTGCGGAATTGGTTAATACTAACAGAGAGATTTGCTCCATTCTCTTTGGAATAACAGGACATGCTGTATAGATACAGGCAGTAGGTTTGCTCTGTACCCATGTGTACAGCCTACCCATGCAGGGACTGGGATTCGAGGACTTCCAGGCGCATAGGGTAGAACCAAATGATAGGGTAGGAGCATGTGTTCTTTAGGGCCTTGTAAGGCTGTTTCCTTTTGCATCTGGAACTGACTATATAATTGTCTTCAATGAAGACTAATTCAATTTTGCATATAGAGGAGCCAAAGAGAGATTTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yone Kawe Lin et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(34), 20776-20784 (2020-08-14)
Transcription factor fusions (TFFs) are present in ∼30% of soft-tissue sarcomas. TFFs are not readily "druggable" in a direct pharmacologic manner and thus have proven difficult to target in the clinic. A prime example is the CIC-DUX4 oncoprotein, which fuses
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline
Yifan Gu et al.
International journal of clinical and experimental medicine, 8(6), 8590-8598 (2015-08-27)
MicroRNAs (miRNAs) are small, non-coding RNAs that modulate gene expression by negatively regulating the stability or translational efficiency of their target mRNAs. The aim of this study was to investigate the expression of microRNA-145 (miR-145) in human papillary thyroid cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico