Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU078751

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Ensembl | nº de acceso humano

ENSG00000141736

Nº de acceso NCBI

NM_004448

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ERBB2(2064) , ERBB2(2064)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yiseul Choi et al.
World journal of gastroenterology, 22(41), 9141-9153 (2016-11-30)
To investigated the relationships between HER2, c-Jun N-terminal kinase (JNK) and protein kinase B (AKT) with respect to metastatic potential of HER2-positive gastric cancer (GC) cells. Immunohistochemistry was performed on tissue array slides containing 423 human GC specimens. Using HER2-positve
Tong Shu et al.
Cancer letters, 411, 65-73 (2017-10-11)
Resistance to platinum-based chemotherapy is a major cause of treatment failure in patients with epithelial ovarian cancer and predicts a poor prognosis. Previously, we found that HECTD3 confers cancer cell resistance to apoptosis. However, the significance of HECTD3 expression in
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
T-T Yu et al.
European review for medical and pharmacological sciences, 24(10), 5267-5280 (2020-06-05)
To explore possible mechanism of ERBB2 gene expression silencing mediating mitogen-activated protein kinase 1/mitogen-activated protein kinase 3 (MAPK1/MAPK3) signaling pathway on proliferation, migration, and invasion of ovarian cancer cells. A total of 240 cancer specimens were collected in patients with
Zhipeng Li et al.
British journal of cancer, 120(3), 306-316 (2018-12-27)
Epidermal growth factor receptor (EGFR) plays an important role in head and neck squamous cell carcinoma (HNSCC) proliferation and therapy resistance, but the efficacy of targeting of EGFR for therapy has been limited. Here, we explore the molecular link between
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico