Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU070621

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN2D

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCGTGGGGTTATGTATCAGAAGAGAGGGGAAGAAACACTTTCTCTTCTTGTTTCTCCTGCCCACTGCTGCAGTAGGGGAGGAGCACAGTTTGTGGCTTATAGGTGTTGGTTTTGGGGGTGTGAGTGTTTGGGGGACGTTTCTCATTTGTTTTTCTCACTCCTTTTGGTGTGTTGGACAGAGAAGGGCTCCTGCAGGCCACAGCCACCTAAACGGTTCAGTTTCTTCTGCGCCTCAGGCTGCTGGGGCCTCAGACGAGACCCAAGGGCAGAGCATTTAAGAGTGAAGTCATGACCTCCAGGGAGCCTAGAAGCTGGTGGCCTTGGCCGGCTGTGCTCAGAGACCTGAAGTGTGCACGTTGCTTCAGGCATGGGGGGTGGGGGGAGCGTCCCAAATCAATAAGAAGGTAGAATGAGTTATGAGTTATTCATATTCTGTTGGAAGCTTGTTTTCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xu Han et al.
Blood, 129(2), 226-237 (2016-11-24)
Terminal erythroid differentiation is tightly coordinated with cell-cycle exit, which is regulated by cyclins, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors (CDKI), yet their roles in erythropoiesis remain to be fully defined. We show here that p19
Tianxiang Wei et al.
Biosensors & bioelectronics, 94, 56-62 (2017-03-05)
MicroRNAs (miRNAs) play important roles in gene regulation and cancer development. Nowadays, it is still a challenge to detect low-abundance miRNAs. Here, we present a magnetic fluorescent miRNA sensing system for the rapid and sensitive detection of miRNAs from cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico