Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU069421

Sigma-Aldrich

MISSION® esiRNA

targeting human BAX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCTGGCGTGAAATGGCGTGATCTGGGCTCACTGCAACCTCTGCCTCCTGGGTTCAAGCGATTCACCTGCCTCAGCATCCCAAGGAGCTGGGATTACAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCC

Ensembl | nº de acceso humano

ENSG00000087088

Nº de acceso NCBI

NM_138764

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BAX(581) , BAX(581)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chia-Hui Huang et al.
Toxicology and applied pharmacology, 334, 35-46 (2017-09-05)
Quinacrine, which is clinically used as an antimalarial drug, has anti-cancer activity. However, mechanism underlying its cytotoxic effect remains to be completely elucidated. In the present study, we investigated the cytotoxic effect of quinacrine on human leukemia U937 cells. Quinacrine-induced
Ilaria Penna et al.
Oncotarget, 7(4), 3947-3965 (2015-12-19)
Intrinsic cross-resistance to inhibition of different signaling pathways may hamper development of combinatorial treatments in melanoma, but the relative frequency of this phenotype and the strategies to overcome this hurdle remain poorly understood. Among 49 BRAF-mutant melanoma cell lines from
Li-han Zhang et al.
Apoptosis : an international journal on programmed cell death, 21(4), 473-488 (2016-01-16)
Epirubicin (EPI) is widely used for triple negative breast cancer (TNBC), but a substantial number of patients develop EPI resistance that is associated with poor outcome. The underlying mechanism for EPI resistance remains poorly understood. We have developed and characterized
Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Bhaskar Saha et al.
Oncotarget, 8(43), 73905-73924 (2017-11-02)
In view of the inadequacy of neuroblastoma treatment, five hydroxystilbenes and resveratrol (Resv) were screened for their cytotoxic property against human neuroblastoma cell lines. The mechanism of cytotoxic action of the most potent compound
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico