Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU050421

Sigma-Aldrich

MISSION® esiRNA

targeting human DPYSL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGAGCGATCGTCTTCTGATCAAAGGAGGTAAAATTGTTAATGATGACCAGTCGTTCTATGCAGACATATACATGGAAGATGGGTTGATCAAGCAAATAGGAGAAAATCTGATTGTGCCAGGAGGAGTGAAGACCATCGAGGCCCACTCCCGGATGGTGATCCCCGGAGGAATTGACGTCCACACTCGTTTCCAGATGCCTGATCAGGGAATGACGTCTGCTGATGATTTCTTCCAAGGAACCAAGGCGGCCCTGGCTGGGGGAACCACTATGATCATTGACCACGTTGTTCCTGAGCCTGGGACAAGCCTGCTCGCTGCCTTTGACCAGTGGAGGGAATGGGCCGACAGCAAGTCCTGCTGTGACTACTCTCTGCATGTGGACATCAGTGAGTGGCATAAGGGCATCCAGGAGGAGATGGAAGCGCTTGTGAAGGATCACGGGGTAAATTCC

Ensembl | nº de acceso humano

ENSG00000092964

Nº de acceso NCBI

NM_001386

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DPYSL2(1808) , DPYSL2(1808)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hervé Husson et al.
Human molecular genetics, 25(11), 2245-2255 (2016-10-30)
Polycystic kidney diseases (PKDs) comprise a subgroup of ciliopathies characterized by the formation of fluid-filled kidney cysts and progression to end-stage renal disease. A mechanistic understanding of cystogenesis is crucial for the development of viable therapeutic options. Here, we identify
Lokesh Agrawal et al.
Neuropharmacology, 158, 107712-107712 (2019-07-22)
Serotonin (5-HT) homeostasis is critical for the brain development which influences neurogenesis, neuronal migration, and circuit formation. Distinctive distribution patterns of serotonin receptors (5-HTRs) in the brain govern various physiological activities. Amongst the 5-HTRs, serotonin 4 receptor (5-HT4R) is widely
Eun J Na et al.
Frontiers in molecular neuroscience, 10, 288-288 (2017-10-03)
Collapsin response mediator protein (CRMP)-2 and the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway are associated with common physiological functions such as neuronal polarity, axonal outgrowth and synaptic strength, as well as various brain disorders including epilepsy. But
Laura Duciel et al.
Scientific reports, 9(1), 2990-2990 (2019-03-01)
Uveal melanoma (UM) is an aggressive tumor in which approximately 50% of patients develop metastasis. Expression of the PTP4A3 gene, encoding a phosphatase, is predictive of poor patient survival. PTP4A3 expression in UM cells increases their migration in vitro and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico