Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU037241

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAGAGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAACCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCAAACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATGGCGTCTGCTCTGGTGGCTTAAGTGA

Ensembl | nº de acceso humano

ENSG00000166949

Nº de acceso NCBI

NM_005902

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SMAD3(4088) , SMAD3(4088)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S Muppala et al.
Oncogene, 36(36), 5189-5198 (2017-05-10)
TGF-β is a multifunctional cytokine affecting many cell types and implicated in tissue remodeling processes. Due to its many functions and cell-specific effects, the consequences of TGF-β signaling are process-and stage-dependent, and it is not uncommon that TGF-β exerts distinct
Zheng Jiang et al.
Journal of biochemistry, 165(4), 317-322 (2018-12-12)
Radiotherapy is the major treatment modality for malignant glioma. However, the treatment response of radiotherapy is suboptimal due to resistance. Here we aimed to explore the effect and mechanism of Mothers against decapentaplegic homologue (SMAD3) silencing in sensitizing malignant glioma
Nao Hiwatashi et al.
The Laryngoscope, 127(9), E308-E316 (2017-05-26)
Recent reports highlight the efficacy of small interfering RNA (siRNA) targeting SMAD3 to regulate transforming growth factor β (TGF-β)-mediated fibroplasia in vocal fold fibroblasts. The current study sought to investigate SMAD3 expression during wound healing in vivo and quantify the
Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico