Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU024601

Sigma-Aldrich

MISSION® esiRNA

targeting human MTDH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCACAGTTACCACCGAGCAACTTACAACCGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAATCTGGAAAAGGAGATTCTACACTTCAGGTTTCTTCAGGATTGAATGAAAACCTCACTGTCAATGGAGGAGGCTGGAATGAAAAGTCTGTAAAACTCTCCTCACAGATCAGTGCAGGTGAGGAGAAGTGGAACTCCGTTTCACCTGCTTCTGCAGGAAAGAGGAAAACTGAGCCATCTGCCTGGAGTCAAGACACTGGAGATGCTAATACAAATGGAAAAGACTGGGGAAGGAGTTGGAGTGACCGTTCAATATTTTCTGGCATTGGGTCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCCTATATCGATGATGAATGGTCTGGGTTAAATGGTCTGTCTTCTGCTGATCCCA

Ensembl | nº de acceso humano

ENSG00000147649

Nº de acceso NCBI

NM_178812

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MTDH(92140) , MTDH(92140)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rongquan He et al.
American journal of translational research, 9(4), 1561-1579 (2017-05-05)
Recent studies found that metadherin (MTDH) played an essential role in hepatocellular carcinoma (HCC). Nevertheless, the exact function of MTDH in the pathogenesis of HCC was unclarified. In the present study, we aimed to investigate the clinical significance of MTDH
Yongfeng Zhang et al.
Molecular medicine reports, 18(3), 3099-3105 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating gene expression by directly binding to the 3'‑untranslated regions of target genes. Multiple miRNAs are dysregulated in retinoblastoma (RB) and their dysregulation is closely related to RB malignancy. Therefore, exploring the detailed roles
Chen Liang et al.
Experimental and therapeutic medicine, 21(1), 22-22 (2020-11-26)
Vasculogenic mimicry (VM) contributes to the resistance of anti-angiogenic therapies in glioma. Certain genes, including MMP-2 and VEGF may be associated with the development of VM. Astrocyte elevated gene-1 (AEG-1) is considered to be an oncogene that promotes autophagy, invasion
Fan Yang et al.
OncoTargets and therapy, 12, 4415-4426 (2019-06-27)
Purpose: Several microRNAs (miRNAs) that are aberrantly expressed in glioblastoma multiforme (GBM) play a significant role in GBM formation and progression. The expression profile and functions of miR-559 in GBM remain unclear. Here, we quantified the expression and investigated the
Dong Pan et al.
International journal of oncology, 54(6), 1955-1968 (2019-05-14)
Studies have rarely been conducted on the role of miRNAs in prostate cancer (PCa) cell progression by directly targeting MTDH, at least to the best of our knowledge. Thus, the present study aimed to identify miRNAs closely related with metadherin
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico