Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU017091

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGC

Ensembl | nº de acceso humano

ENSG00000167325

Nº de acceso NCBI

NM_001033

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RRM1(6240) , RRM1(6240)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zarah Glad Zimling et al.
Anticancer research, 35(12), 6731-6738 (2015-12-08)
A possible predictive impact of ribonucleotide-reductase subunit-1 (RRM1) on vinorelbine efficacy in non-small cell lung cancer (NSCLC) has been previously reported. The present study aimed to further explore this finding in malignant pleural mesothelioma (MPM). Seventy-one patients with MPM receiving
Ribonucleotide Reductase Catalytic Subunit M1 (RRM1) as a Novel Therapeutic Target in Multiple Myeloma.
Morihiko Sagawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(17), 5225-5237 (2017-04-27)
Zhen Shu et al.
Oncogene, 39(35), 5721-5733 (2020-07-28)
Ribonucleotide reductase (RNR) catalyzes the rate-limiting step of de novo synthesis of deoxyribonucleotide triphosphates (dNTPs) building blocks for DNA synthesis, and is a well-recognized target for cancer therapy. RNR is a heterotetramer consisting of two large RRM1 subunits and two
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Jianmei Wu et al.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)
Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico