Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU012661

Sigma-Aldrich

MISSION® esiRNA

targeting human PEBP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATAGACCCACCAGCATTTCGTGGGATGGTCTTGATTCAGGGAAGCTCTACACCTTGGTCCTGACAGACCCGGATGCTCCCAGCAGGAAGGATCCCAAATACAGAGAATGGCATCATTTCCTGGTGGTCAACATGAAGGGCAATGACATCAGCAGTGGCACAGTCCTCTCCGATTATGTGGGCTCGGGGCCTCCCAAGGGCACAGGCCTCCACCGCTATGTCTGGCTGGTTTACGAGCAGGACAGGCCGCTAAAGTGTGACGAGCCCATCCTCAGCAACCGATCTGGAGACCACCGTGGCAAATTCAAGGTGGCGTCCTTCCGTAAAAAGTATGAGCTCAGGGCCCCGGTGGCTGGCACGTGTTACCAGGCCGAGTGGGATGACTATGTGCCCAAACTGTACGAGCAGCTGTCTGGGAAGTAGGGGGTTAGCTTGGGGACCTGAACTGTCCTGGAGGCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTTCTCCTCTTCCTGCCC

Ensembl | nº de acceso humano

ENSG00000089220

Nº de acceso NCBI

NM_002567

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PEBP1(5037) , PEBP1(5037)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zixuan Gong et al.
Cancer management and research, 12, 9327-9338 (2020-10-17)
Much evidence unveils the significance of long non-coding RNAs (lncRNAs) in diverse cancers. This study was designed to clarify the function and mechanism of lncRNA GATA6 antisense RNA 1 (GATA6-AS1) in the progression of non-small cell lung cancer (NSCLC). GATA6-AS1
Yun Wang et al.
Oncology reports, 34(4), 2106-2114 (2015-08-05)
The Raf kinase inhibitor protein (RKIP) is a novel metastasis suppressor. RKIP was previously found to have low expression in a colorectal cancer (CRC) patient cohort by immunohistochemistry. However, the role of RKIP in CRC remains undetermined. In the present
Andrey Kazakov et al.
Basic research in cardiology, 113(6), 42-42 (2018-09-08)
Fibrosis is a hallmark of maladaptive cardiac remodelling. Here we report that genome-wide quantitative trait locus (QTL) analyses in recombinant inbred mouse lines of C57BL/6 J and DBA2/J strains identified Raf Kinase Inhibitor Protein (RKIP) as genetic marker of fibrosis progression.
Quanfang Huang et al.
Journal of cellular biochemistry, 120(4), 6168-6177 (2018-10-12)
The purpose of this study was to investigate the effect of Raf kinase inhibitor protein (RKIP) on the growth, apoptosis, invasion, and metastasis of human hepatic stellate cell line (LX-2). A recombinant plasmid (pcDNA3.1-RKIP) or RKIP-targeting small interfering RNA (siRNA)
Hae Sook Noh et al.
Autophagy, 12(11), 2183-2196 (2016-11-02)
Autophagy plays a critical role in maintaining cell homeostasis in response to various stressors through protein conjugation and activation of lysosome-dependent degradation. MAP1LC3B/LC3B (microtubule- associated protein 1 light chain 3 β) is conjugated with phosphatidylethanolamine (PE) in the membranes and
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico