Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU011421

Sigma-Aldrich

MISSION® esiRNA

targeting human GC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGATCCAGGAAACACCAAAGTCATGGATAAGTATACATTTGAACTAAGCAGAAGGACTCATCTTCCGGAAGTATTCCTCAGTAAGGTACTTGAGCCAACCCTAAAAAGCCTTGGTGAATGCTGTGATGTTGAAGACTCAACTACCTGTTTTAATGCTAAGGGCCCTCTACTAAAGAAGGAACTATCTTCTTTCATTGACAAGGGACAAGAACTATGTGCAGATTATTCAGAAAATACATTTACTGAGTACAAGAAAAAACTGGCAGAGCGACTAAAAGCAAAATTGCCTGATGCCACACCCACGGAACTGGCAAAGCTGGTTAACAAGCACTCAGACTTTGCCTCCAACTGCTGTTCCATAAACTCACCTCCTCTTTACTGTGATTCAGAGATTGATGCTGAATTGAAGAATATCCTGTAGTCCTGAAGCATGTTTATTAACTTTGACCAGAGTTGGAGCCACCCAGGGGAATGATCTCTGATGACCTAACCTAAGCAAAACCACTGAGCTTCTGGGA

Ensembl | nº de acceso humano

ENSG00000145321

Nº de acceso NCBI

NM_000583

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GC(2638) , GC(2638)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mo-Yan Hu et al.
Developmental and comparative immunology, 54(1), 20-31 (2015-09-01)
Rac1, a Rho GTPase, serves critical immunological functions in mammals. Here, a Rac1 homolog (gcRac1) was identified in grass carp (Ctenopharyngodon idella). The full-length 2023-base pair gcRac1 cDNA contained a 579-bp open reading frame encoding a 192-residue protein, including a
Jong-Won Lim et al.
Human molecular genetics, 24(17), 4817-4828 (2015-06-05)
Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico