Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU008631

Sigma-Aldrich

MISSION® esiRNA

targeting human USP37

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAGGTTCAGCACTCCATCATTTGTAAAGCATGTGGAGAGATTATCCCCAAAAGAGAACAGTTTAATGACCTCTCTATTGACCTTCCTCGTAGGAAAAAACCACTCCCTCCTCGTTCAATTCAAGATTCTCTTGATCTTTTCTTTAGGGCCGAAGAACTGGAGTATTCTTGTGAGAAGTGTGGTGGGAAGTGTGCTCTTGTCAGGCACAAATTTAACAGGCTTCCTAGGGTCCTCATTCTCCATTTGAAACGATATAGCTTCAATGTGGCTCTCTCGCTTAACAATAAGATTGGGCAGCAAGTCATCATTCCAAGATACCTGACCCTGTCATCTCATTGCACTGAAAATACAAAACCACCTTTTACCCTTGGTTGGAGTGCACATATGGCAATTTCTAGACCATTGAAAGCCTCTCAAATGGTGAATTCCTGCA

Ensembl | nº de acceso humano

ENSG00000135913

Nº de acceso NCBI

NM_020935

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... USP37(57695) , USP37(57695)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Debjani Pal et al.
Cell death & disease, 11(4), 298-298 (2020-04-30)
APC/CCdh1 is a ubiquitin ligase with roles in numerous diverse processes, including control of cellular proliferation and multiple aspects of the DNA damage response. Precise regulation of APC/CCdh1 activity is central to efficient cell-cycle progression and cellular homeostasis. Here, we
Seok Kim et al.
Cancers, 11(3) (2019-03-14)
WP1130, a partially selective deubiquitinases (DUB) inhibitor, inhibits the deubiquitinating activities of USP5, USP9X, USP14, USP37, and UCHL1. In this study, we investigate whether WP1130 exerts sensitizing effect on TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in human renal carcinoma cells. Combinations
Zhenna Xiao et al.
American journal of cancer research, 9(12), 2749-2759 (2020-01-09)
SNAI1, an epithelial-mesenchymal transition (EMT)-inducing transcription factor, promotes tumor metastasis and resistance to apoptosis and chemotherapy. SNAI1 protein levels are tightly regulated by proteolytic ubiquitination. Here, we identified USP37 as a SNAI1 deubiquitinase that removes the polyubiquitination chain from SNAI1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico