Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU002301

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGAV

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTGCATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAACTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATTTGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATCTTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCCAAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTATGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA

Ensembl | nº de acceso humano

ENSG00000138448

Nº de acceso NCBI

NM_002210

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ITGAV(3685) , ITGAV(3685)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bin Zhang et al.
Cancer letters, 459, 204-215 (2019-06-15)
Macrophage-targeted therapy offers new options for intractable pancreatic ductal adenocarcinoma (PDAC), which has a low 5-year survival rate. However, the factors regulating the biological function and phenotype of macrophages in PDAC are incompletely understood. Here, we found that CD51 was
Weikun Xiao et al.
Matrix biology : journal of the International Society for Matrix Biology, 85-86, 128-146 (2019-04-28)
Originating in the brain, glioblastoma (GBM) is a highly lethal and virtually incurable cancer, in large part because it readily develops resistance to treatments. While numerous studies have investigated mechanisms enabling GBM cells to evade chemotherapy-induced apoptosis, few have addressed
Chuyue Zhang et al.
ACS nano, 14(9), 12133-12147 (2020-08-14)
Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-EVs) have been recognized as a promising cell-free therapy for acute kidney injury (AKI), which avoids safety concerns associated with direct cell engraftment. However, low stability and retention of MSC-EVs have limited
Huashe Wang et al.
Pathology, research and practice, 215(9), 152531-152531 (2019-07-20)
Integrin subunit alpha V (ITGAV), a member of integrin family of extracellular matrix receptors, is involved in many types of cancer. In this study, the expression levels, clinical features and prognosis of ITGAV in gastric cancer (GC) patients were investigated
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico