Skip to Content
Merck
All Photos(1)

Key Documents

47119

Supelco

Peanut oil

analytical standard

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

CAS Number:
EC Number:
MDL number:
UNSPSC Code:
12164500

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

grade

analytical standard

packaging

ampule of 1000 mg

technique(s)

HPLC: suitable
gas chromatography (GC): suitable

density

0.91 g/mL at 25 °C (lit.)

application(s)

food and beverages

format

neat

functional group

oleic acid

shipped in

ambient

storage temp.

room temp

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU064031EHU106791EHU079011
esiRNA cDNA target sequence

CCTTGAGGCTTCTCTTGGTGTCCATACATATGAACTGGCTATGAACCACCTGGGGGACATGACCAGTGAAGAGGTGGTTCAGAAGATGACTGGACTCAAAGTACCCCTGTCTCATTCCCGCAGTAATGACACCCTTTATATCCCAGAATGGGAAGGTAGAGCCCCAGACTCTGTCGACTATCGAAAGAAAGGATATGTTACTCCTGTCAAAAATCAGGGTCAGTGTGGTTCCTGTTGGGCTTTTAGCTCTGTGGGTGCCCTGGAGGGCCAACTCAAGAAGAAAACTGGCAAACTCTTAAATCTGAGTCCCCAGAACCTAGTGGATTGTGTGTCTGAGAATGATGGCTGTGGAGGGGGCTACATGACCAATGCCTTCCAATATGTGCAGAAGAACCGGGGTATTGACTCTGAAGATGCCTACCCATATGTGGG

esiRNA cDNA target sequence

GCAGATGATGGGTTGCTTTCGAAACCAGAAATTCAGGAAGGGGAAAGTGTTCCGTGAGCCTCTGTTTCTTGATCTTCCCAAATCTGTGGATTGGAGAAAGAAAGGCTACGTGACGCCAGTGAAGAATCAGAAACAGTGTGGTTCTTGTTGGGCTTTTAGTGCGACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAAACTTGTCTCACTGAGCGAGCAGAATCTGGTGGACTGTTCGCGTCCTCAAGGCAATCAGGGCTGCAATGGTGGCTTCATGGCTAGGGCCTTCCAGTATGTCAAGGAGAACGGAGGCCTGGACTCTGAGGAATCCTATCCATATGTAGCAGTGGATGAAATCTGTAAGTACAGACCTGAGAATTCTGTTGCTAATGACACTGGCTTCACAGTGG

esiRNA cDNA target sequence

ACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACATGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTG

esiRNA cDNA target sequence

ACCGGAAAGATGCTGTCCTTGGCGGAACAGCAGCTGGTGGACTGCGCCCAGGACTTCAATAATCACGGCTGCCAAGGGGGTCTCCCCAGCCAGGCTTTCGAGTATATCCTGTACAACAAGGGGATCATGGGTGAAGACACCTACCCCTACCAGGGCAAGGATGGTTATTGCAAGTTCCAACCTGGAAAGGCCATCGGCTTTGTCAAGGATGTAGCCAACATCACAATCTATGACGAGGAAGCGATGGTGGAGGCTGTGGCCCTCTACAACCCTGTGAGCTTTGCCTTTGAGGTGACTCAGGACTTCATGATGTATAGAACCGGCATCTACTCCAGTACTTCCTGCCATAAAACTCCAGATAAAGTAAACCATGCAGTACTGGCTGTTGGGTATGGAGAAAAAAATGGGATCCCTTACTGGATCGTGAAAAACTCTTGGGGT

Ensembl | human accession no.

ENSG00000143387

Ensembl | human accession no.

ENSG00000136943

Ensembl | human accession no.

ENSG00000135047

Ensembl | human accession no.

ENSG00000103811

Gene Information

human ... CTSK(1513), CTSK(1513)

Gene Information

human ... CTSV(1515), CTSL2(1515)

Gene Information

human ... CTSL(1514), CTSL1(1514)

Gene Information

human ... CTSH(1512), CTSH(1512)

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

This reference material is offered as a qualitative standard. Use the chromatographic fingerprint of our reference material to check for the presence of peanut oil in your sample. A Certificate of Composition which includes a chromatogram is shipped with each product.

Application

Refer to the product′s Certificate of Analysis for more information on a suitable instrument technique. Contact Technical Service for further support.

Storage Class Code

10 - Combustible liquids

WGK

nwg

Flash Point(F)

539.6 °F - closed cup

Flash Point(C)

282 °C - closed cup

Personal Protective Equipment

dust mask type N95 (US), Eyeshields, Gloves

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chang Li et al.
Journal of food science, 77(4), C394-C400 (2012-03-08)
Antioxidant efficacy of 70% ethanol extract (EE), 70% methanol extract (ME), and water extract (WE) produced from pickled and dried mustard (Brassica juncea Coss. var. foliosa Bailey) was evaluated in rapeseed and peanut oils by using the Schaal oven method.
Bo Zhang et al.
Frontiers in neuroscience, 14, 847-847 (2020-08-28)
Cerebral ischemia is a major cause of brain dysfunction, neuroinflammation and oxidative stress have been implicated in the pathophysiological process of cerebral ischemia/reperfusion injury. Celastrol is a potent inhibitor of inflammation and oxidative stress that has little toxicity. The present
Jun Hu et al.
Journal of separation science, 36(2), 288-300 (2012-12-04)
The complexity of natural triacylglycerols (TAGs) in various edible oils is prodigious due to the hundreds of set is of TAG compositions, which makes the identification of TAGs quite difficult. In this investigation, the off-line 2D system coupling of nonaqueous
J B Mbarga et al.
Communications in agricultural and applied biological sciences, 77(3), 65-73 (2012-01-01)
The objective of this study was therefore to develop a formulation of conidia of T. asperellum with the aim of improving its efficacy. The formulations developed were oily dispersions. It was a combination of solvents consisting of groundnut oil or
Liang-Wu Cai et al.
The Journal of the Acoustical Society of America, 129(1), 12-23 (2011-02-10)
A computational procedure for analyzing acoustical scattering by multilayer concentric spherical scatterers having an arbitrary mixture of acoustic and elastic materials is proposed. The procedure is then used to analyze the scattering by a spherical scatterer consisting of a solid

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service