Skip to Content
Merck
All Photos(1)

Documents

EHU057691

Sigma-Aldrich

MISSION® esiRNA

targeting human LCP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGTGTTAACCCTCGAGTCAATCATTTGTACAGTGACTTATCAGATGCCCTGGTCATCTTCCAGCTCTATGAAAAGATCAAAGTTCCTGTTGACTGGAACAGAGTAAACAAACCGCCATACCCCAAACTGGGAGGCAATATGAAGAAGCTTGAGAATTGTAACTACGCGGTAGAATTGGGGAAGAATCAAGCGAAGTTCTCCCTGGTTGGCATCGGTGGACAAGATCTCAATGAAGGAAACCGCACTCTCACACTGGCCTTGATTTGGCAGCTAATGAGAAGGTATACACTGAATATCCTCGAAGAAATTGGTGGTGGCCAGAAGGTCAATGATGACATTATTGTCAACTGGGTGAATGAAACATTGAGGGAAGCAAAGAAAAGTTCATCCATCTCTAGTTTCAAGGACCCGAAGATTAGTACAAGTCTGCCTGTTCTGGACCTC

Ensembl | human accession no.

ENSG00000136167

NCBI accession no.

NM_002298

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LCP1(3936) , LCP1(3936)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Yan Wang et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(4), 747-759 (2019-03-22)
Long noncoding RNAs (lncRNA) expression profiles change in the ischemic brain after stroke, but their roles in specific cell types after stroke have not been studied. We tested the hypothesis that lncRNA modulates brain injury by altering macrophage functions. Using
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service