Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU059761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gsk3b

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGCCACAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCATCGAGACAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
Yunfeng Fu et al.
OncoTargets and therapy, 7, 1159-1168 (2014-07-17)
Glycogen synthase kinase-3 (GSK-3) plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/β(Tyr279/216) in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition
I Azoulay-Alfaguter et al.
Oncogene, 34(35), 4613-4623 (2014-12-17)
There is controversy over the role of glycogen synthase kinase-3 (GSK-3) in cancer progression. Recent work has implicated GSK-3 in the regulation of mammalian target of rapamycin (mTOR), a known player in malignant transformation. Autophagy, a self-degradation pathway, is inhibited

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico