Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU138421

Sigma-Aldrich

MISSION® esiRNA

targeting human DHODH

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGAAAGAGCAGGGCTTTGGCGGAGTCACAGATGCCATTGGAGCAGATCATCGGAGGTGAGGACAGCGTCTGACGGGAAGCCTGATCTGGAACCTTCCCAAGGACTCAGGCAAGCCTTTGTGGCTGGATCATGAGAGGAGGGACTCCATCTTGAGCCATGTCCCCCAGCCATGGCATGGCTGCACTGTAAACGCCAATCGGGGGGTCACCAGGATCAACCGCAGGCTTTCTTCAGTCCCTTGGTCAGACCATAAACTGCATTTTTGATTCTTTGTGGATTCAAACCCTAGGATCCATCAGTCTTGCAAGGACATTGAATATTAGGAGGAAAAAGTCATGGAAAAAATAAAGCCATTTAGAACCTGGGTTTCAACGCTAGCCCTTTCTGGTTTGCCATAGGCCCTGCCAAGATACTGCAGGTCCATCCAGG

Numéro d'accès Ensembl | humain

ENSG00000102967

Numéro d'accès NCBI

NM_001361

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DHODH(1723) , DHODH(1723)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuemei Qiu et al.
International journal of oral science, 13(1), 3-3 (2021-01-30)
Oral squamous cell carcinoma (OSCC) become a heavy burden of public health, with approximately 300 000 newly diagnosed cases and 145 000 deaths worldwide per year. Nucleotide metabolism fuel DNA replication and RNA synthesis, which is indispensable for cell proliferation.
Mathura Subangari Dorasamy et al.
Journal of Cancer, 8(15), 3086-3098 (2017-09-21)
Dihydroorotate dehydrogenase (DHODH) is a rate-limiting enzyme in the
Deepti Mathur et al.
Cancer discovery, 7(4), 380-390 (2017-03-04)
Metabolic changes induced by oncogenic drivers of cancer contribute to tumor growth and are attractive targets for cancer treatment. Here, we found that increased growth of PTEN-mutant cells was dependent on glutamine flux through the de novo pyrimidine synthesis pathway
T He et al.
Oncogene, 33(27), 3538-3549 (2013-09-10)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising agent in selectively killing tumor cells. However, TRAIL monotherapy has not been successful as many cancer cells are resistant to TRAIL. Chemotherapeutic agents, such as doxorubicin have been shown to act

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique