Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

Numéro d'accès Ensembl | humain

ENSG00000100811

Numéro d'accès NCBI

NM_003403

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... YY1(7528) , YY1(7528)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
J-B Tian et al.
European review for medical and pharmacological sciences, 23(13), 5714-5729 (2019-07-13)
Increasing studies have confirmed long non-coding RNAs (lncRNAs) as novel regulators in tumorigenesis. LncRNA DDX11 antisense RNA 1 (DDX11-AS1) has been found to be abnormally expressed in several tumors. In this work, we aimed to evaluate its expressions and functions
Huan Liu et al.
Scientific reports, 10(1), 20493-20493 (2020-11-26)
Angiogenesis is a physiological process for the formation of new blood vessels from the pre-existing vessels and it has a vital role in the survival and growth of neoplasms. During tumor angiogenesis, the activation of the gene transcriptions in vascular
Giulio Morozzi et al.
Cell death and differentiation, 24(12), 2077-2088 (2017-09-09)
Muscles of sarcopenic people show hypotrophic myofibers and infiltration with adipose and, at later stages, fibrotic tissue. The origin of infiltrating adipocytes resides in fibro-adipogenic precursors and nonmyogenic mesenchymal progenitor cells, and in satellite cells, the adult stem cells of
Feng Liang et al.
Journal of cellular biochemistry, 120(10), 18415-18424 (2019-06-14)
Lacking of diagnostic and prognostic biomarkers is a significant reason for the poor prognosis of patients with triple-negative breast cancer (TNBC). MicroRNAs (miRNAs) have been discovered to engage in the tumorigenesis and development of TNBC. miR-5590-3p has been found to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique