Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU001691

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTGCCAATTGAAACATCCTTCTATCTTGGAGCTTTATAACTATTTTGAAGATAGCAATTATGTGTATCTGGTATTAGAAATGTGCCATAATGGAGAAATGAACAGGTATCTAAAGAATAGAGTGAAACCCTTCTCAGAAAATGAAGCTCGACACTTCATGCACCAGATCATCACAGGGATGTTGTATCTTCATTCTCATGGTATACTACACCGGGACCTCACACTTTCTAACCTCCTACTGACTCGTAATATGAACATCAAGATTGCTGATTTTGGGCTGGCAACTCAACTGAAAATGCCACATGAAAAGCACTATACATTATGTGGAACTCCTAACTACATTTCACCAGAAATTGCCACTCGAAGTGCACATGGCCTTGAATCTGATGTTTGGTCCCTGGGCTGTATGTTTTATACATTACTTATCGGGAGACCACCCT

Numéro d'accès Ensembl | humain

ENSG00000142731

Numéro d'accès NCBI

NM_014264

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PLK4(10733) , PLK4(10733)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fernando R Balestra et al.
eLife, 10 (2021-01-26)
TRIM37 is an E3 ubiquitin ligase mutated in Mulibrey nanism, a disease with impaired organ growth and increased tumor formation. TRIM37 depletion from tissue culture cells results in supernumerary foci bearing the centriolar protein Centrin. Here, we characterize these centriolar
C O Rosario et al.
Oncogene, 34(26), 3441-3451 (2014-09-02)
Polo family kinase 4 (Plk4) is required for mitotic progression, and is haploinsufficient for tumor suppression and timely hepatocyte polarization in regenerating liver. At the same time, recent evidence suggests that Plk4 expression may have a role in clinical cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique