Skip to Content
Merck
All Photos(1)

Documents

EHU081071

Sigma-Aldrich

MISSION® esiRNA

targeting human DUSP6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCCTTCAGCAGTTTCTCTTGGCAGCATCAGCTGGGCTGCTTTCTTTGTGTGTGGCCCCAGGTGTCAAAATGACACCAGCTGTCTGTACTAGACAAGGTTACCAAGTGCGGAATTGGTTAATACTAACAGAGAGATTTGCTCCATTCTCTTTGGAATAACAGGACATGCTGTATAGATACAGGCAGTAGGTTTGCTCTGTACCCATGTGTACAGCCTACCCATGCAGGGACTGGGATTCGAGGACTTCCAGGCGCATAGGGTAGAACCAAATGATAGGGTAGGAGCATGTGTTCTTTAGGGCCTTGTAAGGCTGTTTCCTTTTGCATCTGGAACTGACTATATAATTGTCTTCAATGAAGACTAATTCAATTTTGCATATAGAGGAGCCAAAGAGAGATTTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yone Kawe Lin et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(34), 20776-20784 (2020-08-14)
Transcription factor fusions (TFFs) are present in ∼30% of soft-tissue sarcomas. TFFs are not readily "druggable" in a direct pharmacologic manner and thus have proven difficult to target in the clinic. A prime example is the CIC-DUX4 oncoprotein, which fuses
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline
Yifan Gu et al.
International journal of clinical and experimental medicine, 8(6), 8590-8598 (2015-08-27)
MicroRNAs (miRNAs) are small, non-coding RNAs that modulate gene expression by negatively regulating the stability or translational efficiency of their target mRNAs. The aim of this study was to investigate the expression of microRNA-145 (miR-145) in human papillary thyroid cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service