Skip to Content
Merck
All Photos(1)

Key Documents

EHU130461

Sigma-Aldrich

MISSION® esiRNA

targeting human ALDH2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Xue et al.
Biochemical and biophysical research communications, 512(2), 319-325 (2019-03-20)
Moderate alcohol consumption has been shown to reduce atherosclerosis-associated diseases. As shown in our earlier works, ethanol has a dose-dependent protective effects against endothelial cellular senescence by activating aldehyde dehydrogenase 2 (ALDH2) in vitro. However, whether ethanol administration possesses anti-atherosclerosis properties
Alcohol Dehydrogenase 5 Is a Source of Formate for De Novo Purine Biosynthesis in HepG2 Cells.
Sajin Bae et al.
The Journal of nutrition, 147(4), 499-505 (2017-02-24)
Govindasamy-Muralidharan Karthik et al.
Cancer letters, 367(1), 76-87 (2015-07-26)
Breast cancer cells with stem cell characteristics (CSC) are a distinct cell population with phenotypic similarities to mammary stem cells. CSCs are important drivers of tumorigenesis and the metastatic process. Tamoxifen is the most widely used hormonal therapy for estrogen

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service