MLMIR0193

MISSION^® Lenti microRNA, Mouse

mmu-miR-208a-5p

• UNSPSC-Code: 41106609
• NACRES: NA.51

Eigenschaften

• Qualitätsniveau: 200
• Produktlinie: MISSION^®
• Form: liquid
• Konzentration: ≥1x10⁶ VP/ml (via p24 assay)
• Ausgereifte Sequenz: GAGCUUUUGGCCCGGGUUAUAC
• Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen: MIMAT0017014
• Sanger microRNA-Hinterlegungsnummer: MI0000555
• Versandbedingung: dry ice
• Lagertemp.: −70°C

Beschreibung

Allgemeine Beschreibung

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Sonstige Hinweise

Based on miRBase V20 Mature ID

Empfohlene Produkte

Two negative controls are available: NCLMIR001 and NCLMIR002

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sicherheitshinweise

• Lagerklassenschlüssel: 12 - Non Combustible Liquids
• WGK: WGK 3
• Flammpunkt (°F): Not applicable
• Flammpunkt (°C): Not applicable