Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU156431

Sigma-Aldrich

MISSION® esiRNA

targeting human TIMP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAAC

Ensembl | Human Hinterlegungsnummer

ENSG00000102265

NCBI-Hinterlegungsnummer

NM_003254

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TIMP1(7076) , TIMP1(7076)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shu-Mei Huang et al.
Journal of dermatological science, 96(3), 159-167 (2019-11-26)
Macrophages play important roles during wound healing, and delayed healing in diabetics is associated with sustained inflammation. M1 type macrophage is recognized to secrete excessive amount of tumor necrosis factor-alpha (TNF-α) as compared to its M2 counterpart. We hypothesized that
Omar M Omar et al.
Molecular carcinogenesis, 57(11), 1577-1587 (2018-07-24)
Tissue inhibitor matrix metalloproteinase-1 (TIMP1) is one of four identified members of the TIMP family. We evaluated the role of TIMP1 in gastric cancer using human and mouse tissues along with gastric organoids and in vitro cell models. Using quantitative
Fenglin Zhao et al.
International journal of molecular medicine, 44(5), 1609-1618 (2019-09-06)
Parastomal hernia (PH) is a common complication following stoma formation. Abnormal collagen synthesis has been suggested to be involved in PH. The aim of the present study is to explore the effect and mechanism of the collagen synthesis on PH.
Jingshu Tang et al.
Acta pharmaceutica Sinica. B, 10(6), 987-1003 (2020-07-10)
Blood-brain barrier (BBB) breakdown and the associated microvascular hyperpermeability are hallmark features of several neurological disorders, including traumatic brain injury (TBI). However, there is no viable therapeutic strategy to rescue BBB function. Tissue inhibitor of metalloproteinase-1 (TIMP1) has been considered
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.