Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU150081

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCTGTGCTTTGTGGAAGACCCTACTTTCGGATATGAGGACTTCACTCGGAGAGGGGCTCAGGCACCCCCTACCTTCCGGGCCCAGGATTATACCTGGGAAGACCATGGCTACTCGCTGATCCAGCGGCTTTACCCTGAGGGTGGGCAGCTGCTGGATGAGAAGTTCCAGGCAGCCTATAGCCTCACCTACAATACCATCGCCATGCACAGTGGTGTGGACACCTCCGTGCTCCGCAGGGCCATCTGGAACTATATCCACTGCGTCTTTGGCATCAGATATGATGACTATGATTATGGGGAGGTGAACCAGCTCCTGGAGCGGAACCTCAAGGTCTATATCAAGACAGTGGCCTGCTACCCAGAGAAGACCACCCGAAGAATGTACAACCTCTTCTGGAGGCACTTCCGCCACTCAGAGAAG

Ensembl | Human Hinterlegungsnummer

ENSG00000130766

NCBI-Hinterlegungsnummer

NM_031459

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SESN2(83667) , SESN2(83667)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem./physiol. Wirkung

SESN2 (sestrin-2) is a downstream effector of p53. It is associated with cell survival, protection and regeneration. It also plays an important role in autophagy induction and tumor suppression. Overexpression of SENS2 suppresses cancer growth. It controls cell growth and proliferation by suppressing mTORC1 (mammalian target of rapamycin complex 1) activity through an AMPK (5′ AMP-activated protein kinase)-associated mechanism. It is an antioxidant protein, and can be induced by oxidative and energetic stress.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

An ShRNA Based Genetic Screen Identified Sesn2 as a Potential Tumor Suppressor in Lung Cancer via Suppression of Akt-mTOR-p70S6K Signaling.
Xu H
PLoS ONE, 10, e0124033-e0124033 (2015)
SESN2 correlates with advantageous prognosis in hepatocellular carcinoma.
Chen S
Diagnostic Pathology, 12, 13-13 (2017)
Sestrin2: A Promising Therapeutic Target for Liver Diseases.
Kim KM
Biological & Pharmaceutical Bulletin, 38, 966-966 (2015)
Mengjiao Chen et al.
Journal of cellular physiology, 236(1), 392-404 (2020-06-11)
Sestrin2 (SESN2) is a highly conservative oxidative stress protein that can regulate energy metabolism, cell proliferation, apoptosis, and mitochondria autophagy processes. It plays a role as an antioxidant in various diseases. The aims of the present study were to explore
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.