Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU081611

Sigma-Aldrich

MISSION® esiRNA

targeting human MYH9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTCATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTTTTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTATTATCTCCTGTCTGGGGCTGGAGAGCACCTGAAGACC

Ensembl | Human Hinterlegungsnummer

ENSG00000100345

NCBI-Hinterlegungsnummer

NM_002473

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MYH9(4627) , MYH9(4627)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Bo Yang et al.
Nature materials, 19(2), 239-250 (2019-10-30)
A common feature of cancer cells is the alteration of kinases and biochemical signalling pathways enabling transformed growth on soft matrices, whereas cytoskeletal protein alterations are thought to be a secondary issue. However, we report here that cancer cells from
Satyendra Kumar Singh et al.
Medical oncology (Northwood, London, England), 37(10), 88-88 (2020-09-10)
Non-muscle myosin IIA heavy chain (MYH9) has been implicated in many physiological and pathological functions including cell adhesion, polarity, motility to cancer. However, its role in melanoma remains unexplored. The aim of our study was to evaluate the role of
Jeong Suk Kang et al.
Scientific reports, 9(1), 7679-7679 (2019-05-24)
MYH9, a widely expressed gene encoding nonmuscle myosin heavy chain, is also expressed in podocytes and is associated with glomerular pathophysiology. However, the mechanisms underlying MYH9-related glomerular diseases associated with proteinuria are poorly understood. Therefore, we investigated the role and
Shuli Liang et al.
PloS one, 6(4), e18409-e18409 (2011-05-03)
MicroRNAs (miRNAs) are important regulators that play key roles in tumorigenesis and tumor progression. A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. Through miRNA array, we found that let-7f was downregulated
Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.