Direkt zum Inhalt
Merck

EHU078371

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP7B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCTTGCTTGGGGAATGTTGTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Junko Fujiyoshi et al.
Scientific reports, 9(1), 1535-1535 (2019-02-09)
Wilson's disease (WD) is an inherited metabolic disease arising from ATPase copper transporting beta gene (ATP7B) mutation. Orthotoropic liver transplantation is the only radical treatment of fulminant WD, although appropriate donors are lacking at the onset of emergency. Given the
Navasona Krishnan et al.
Genes & development, 32(13-14), 944-952 (2018-06-28)
The levels of copper, which is an essential element in living organisms, are under tight homeostatic control. Inactivating mutations in ATP7B, a P-type Cu-ATPase that functions in copper excretion, promote aberrant accumulation of the metal, primarily the in liver and
Marta Mariniello et al.
Cancers, 12(3) (2020-03-12)
Tumor resistance to chemotherapy represents an important challenge in modern oncology. Although platinum (Pt)-based drugs have demonstrated excellent therapeutic potential, their effectiveness in a wide range of tumors is limited by the development of resistance mechanisms. One of these mechanisms
Xue Fu et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 432-451 (2014-03-13)
Regulation of cellular copper (Cu) homeostasis involves Cu-transporting ATPases (Cu-ATPases), i.e., ATP7A and ATP7B. The question as to how these Cu-ATPases in brain barrier systems transport Cu, i.e., toward brain parenchyma, cerebrospinal fluid (CSF), or blood, remained unanswered. This study

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.