Direkt zum Inhalt
Merck

EHU055401

Sigma-Aldrich

MISSION® esiRNA

targeting human BAG1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shutong Liu et al.
Journal of translational medicine, 15(1), 189-189 (2017-09-08)
In order to improve therapy for head and neck squamous cell carcinoma (HNSCC), biomarkers associated with local and/or distant tumor relapses and cancer drug resistance are urgently needed. This study identified a potential biomarker, Bcl-2 associated athanogene-1 (BAG-1), that is
Pelin Ozfiliz Kilbas et al.
Molecular biology reports, 46(1), 847-860 (2019-01-21)
The multifunctional anti-apoptotic Bag-1 protein has important roles in apoptosis, proteasome-mediated degradation, transcriptional regulation, and intracellular signaling. Bag-1 promotes cell survival and proliferation, and is overexpressed in breast cancer. Therefore, Bag-1-targeted therapy might be a promising strategy to treat breast
Zhili Shen et al.
Molecular medicine reports, 17(5), 7435-7441 (2018-03-24)
Cinobufacini is widely used in the treatment of advanced cancers. It has been previously reported that microRNA (miR)‑494 was upregulated in cinobufacini‑treated gastric cancer cells; however, the detailed role of miR‑494 in the anti‑tumor activity of cinobufacini is unclear. The
Pelin Ozfiliz et al.
Cell biochemistry and function, 33(5), 293-307 (2015-07-17)
Bag-1, Bcl-2 associated athanogene-1, is a multifunctional protein that can regulate a wide variety of cellular processes: proliferation, cell survival, transcription, apoptosis and motility. Bag-1 interacts with various targets in the modulation of these pathways; yet molecular details of Bag-1's

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.