Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU091961

Sigma-Aldrich

MISSION® esiRNA

targeting human FLI1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCC

Ensembl | human accession no.

ENSG00000151702

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FLI1(2313) , FLI1(2313)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Jonathan P Van Beek et al.
Arthritis research & therapy, 8(2), R36-R36 (2006-02-14)
CCN2 is encoded by an immediate-early gene induced in mesenchymal cells during the formation of blood vessels, bone and connective tissue. It plays key roles in cell adhesion and migration, as well as matrix remodeling. CCN2 is overexpressed in fibrosis
Tao He et al.
Gene, 596, 137-146 (2016-10-30)
A translocation leading to the formation of an oncogenic EWS-ETS fusion protein defines Ewing sarcoma. The most frequent gene fusion, present in 85 percent of Ewing sarcomas, is EWS-FLI1. Here, a high-throughput RNA interference screen was performed to identify genes
Samer Kayali et al.
PloS one, 7(10), e46799-e46799 (2012-10-12)
Clonal erythroleukemia developing in susceptible mice infected by Friend virus complex are associated with highly recurrent proviral insertions at one of three loci called Spi-1, Fli-1 or Fli-3, leading to deregulated expression of oncogenic Spi-1 or Fli-1 transcription factors or
Beiping Miao et al.
International journal of cancer, 147(1), 189-201 (2019-12-18)
Binding of transcription factors to mutated DNA sequences is a likely regulator of cancer progression. Noncoding regulatory mutations such as those on the core promoter of the gene encoding human telomerase reverse transcriptase have been shown to affect gene expression
T Miyagawa et al.
Journal of the European Academy of Dermatology and Venereology : JEADV, 33(4), 753-760 (2018-12-07)
Trappin-2/pre-elafin is an endogenous inhibitor of human neutrophil elastase involved in inflammation, innate immunity and vascular remodelling, which consist of the complex pathological process of systemic sclerosis (SSc). To clarify the potential role of trappin-2 in SSc. Serum trappin-2 levels
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.