Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU090501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nsg1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGTGTCACCGAGAGGTTTAAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAGTGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTACAACGTGGCCAAGCAGAGCATCACCCGCTCCGTGTCGCCATGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCGGAACAGGAGACCGAAGCTGCAGAGAAGTCAGCTTAGCGAGCAGGGCAGGTTCCTTACGATGTGTCACTTGAAGGCAACAAGGGGACTTTGAGGGACATTTCATTAAATATAATTACCGATAATTTAGAGATTACTCATTTACGGTGCAATTGCTTCTGTTTGCTAATGCTGCTTTGCAAATTAAACTTGCTGCGGACCACCCACAGGCGTAAGAACAAGAGCATCTCAGCATTGCTTAGAGAGCTGGATGCCACTGTCCACGCTGAGGAGTCTTC

N° accesso Ensembl | topo

ENSMUSG00000029126

N° accesso NCBI

NM_010942

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... NSG1(18196) , Nsg1(18196)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Purusottam Mohapatra et al.
The international journal of biochemistry & cell biology, 66, 75-84 (2015-07-28)
Combination therapy using two or more small molecule inhibitors of aberrant signaling cascade in aggressive breast cancers is a promising therapeutic strategy over traditional monotherapeutic approaches. Here, we have studied the synergistic mechanism of resveratrol and curcumin induced apoptosis using
Daqian Wan et al.
Anti-cancer drugs, 26(9), 931-941 (2015-07-17)
Aspidin PB is a natural product extracted from Dryopteris fragrans (L.) Schott, which has been characterized for its various biological activities. We reported that aspidin PB induced cell cycle arrest and apoptosis through the p53/p21 and mitochondria-dependent pathways in human
Koichi Shoji et al.
Oncology reports, 32(1), 65-70 (2014-05-21)
Fibroblast growth factor receptor 2 (FGFR2) is thought to mediate an important signaling pathway between prostate epithelial cells and stromal cells for maintenance of homeostasis in normal prostate tissue. Abnormalities of FGFR2 have been shown in advanced prostate cancer or
Malte Kriegs et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 115(1), 120-127 (2015-03-23)
How EGF receptor (EGFR) inhibition induces cellular radiosensitization and with that increase in tumor control is still a matter of discussion. Since EGFR predominantly regulates cell cycle and proliferation, we studied whether a G1-arrest caused by EGFR inhibition may contribute
Haizhi Huang et al.
Journal of functional foods, 15, 464-475 (2015-06-27)
Galangin and myricetin are flavonoids isolated from vegetables and fruits which exhibit anti-proliferative activity in human cancer cells. In this study, their anti-angiogenic effects were investigated with
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.