Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU052231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Park7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGCAGTGTAGCCGTGATGTAATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCAGGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGAGCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGGATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAGAGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAGCCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACTAGAGCCCAAGCCC

N° accesso Ensembl | topo

ENSMUSG00000028964

N° accesso NCBI

NP_065594

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... PARK7(57320) , Park7(57320)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jung-Min Kim et al.
Scientific reports, 4, 4805-4805 (2014-06-14)
Adipose tissue functions as an endocrine organ, and the development of systemic inflammation in adipose tissue is closely associated with metabolic diseases, such as obesity and insulin resistance. Accordingly, the fine regulation of the inflammatory response caused by obesity has
Ismail Ahmed Ismail et al.
Journal of cellular physiology, 230(9), 2262-2269 (2015-02-14)
2'-Benzoyloxycinnamaldehyde (BCA) is a promising antitumor agent. BCA effectively inhibited proliferation of MDA-MB-435 more than in MCF-7 breast cancer cells. Our recent findings showed that DJ-1 protects MCF7 cells from BCA-induced oxidative stress via its mitochondrial translocation and inhibition of
Min Sik Choi et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(45), 15123-15131 (2014-11-08)
Emerging evidence suggests that oxidative/nitrosative stress, as occurs during aging, contributes to the pathogenesis of Parkinson's disease (PD). In contrast, detoxification of reactive oxygen species and reactive nitrogen species can protect neurons. DJ-1 has been identified as one of several
Hong Zhu et al.
Free radical biology & medicine, 71, 121-132 (2014-04-01)
Dihydroartemisinin (DHA), one of the main metabolites of artemisinin and its derivatives, presents anti-cancer potential in vitro and in vivo. To explore the mechanisms of resistance toward DHA, a DHA-resistant cell line, HeLa/DHA, was established with a resistance factor of
Cailing Liu et al.
Investigative ophthalmology & visual science, 55(9), 5551-5560 (2014-08-02)
To investigate the role of DJ-1 in Nrf2-regulated antioxidant defense in corneal endothelial cells (CECs) at baseline and in response to ultraviolet A (UV-A)-induced oxidative stress. DJ-1-deficient CECs were obtained by transfection of an immortalized normal human corneal endothelial cell
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.