Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU048461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rictor

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGAAAGCAATCGCAACTCACCACAAGCGGGATCAGTATCTTCGAGTTCAGAAAGATATATTTGTTCTTAAGGATACAGAGGAAGCTCTTTTAATAAACCTTAGAGACAGCCAAGTCCTTCAGCATAAAGAGAATCTTGACTGGGATTGGAATCTGATTGGGACCATCCTTAAGTGGCCAAATGTAAATCTAAGAAACTATAAAGATGAGCAGTTGCACAGGTTTGTGCGCAGACTTCTTTACTTTTACAAGCCCAGCAGCAAACTGTACGCTAGTCTGGATCTGGACTTGGCCAAGTCCAAGCAGCTCACAGTTGTCGGTTGTCAGTTTACAGAATTTCTGCTCGAGTCTGAAGAGGATGGGCAAGGATACTTAGAAGATCTCGTGAAAGATATTGTTCAGTGGCTCAATGCTTCA

N° accesso Ensembl | topo

ENSMUSG00000050310

N° accesso NCBI

NM_030168

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... RICTOR(78757) , 4921505C17Rik(78757)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Haiying Cheng et al.
Cancer discovery, 5(12), 1262-1270 (2015-09-16)
We identified amplification of RICTOR, a key component of the mTOR complex 2 (mTORC2), as the sole actionable genomic alteration in an 18-year-old never-smoker with lung adenocarcinoma. Amplification of RICTOR occurs in 13% of lung cancers (1,016 cases) in The
Maikel A Farhan et al.
PloS one, 10(8), e0135245-e0135245 (2015-08-22)
Tumor neovascularization is targeted by inhibition of vascular endothelial growth factor (VEGF) or the receptor to prevent tumor growth, but drug resistance to angiogenesis inhibition limits clinical efficacy. Inhibition of the phosphoinositide 3 kinase pathway intermediate, mammalian target of rapamycin
Wenteh Chang et al.
PloS one, 9(8), e106155-e106155 (2014-08-28)
A characteristic of dysregulated wound healing in IPF is fibroblastic-mediated damage to lung epithelial cells within fibroblastic foci. In these foci, TGF-β and other growth factors activate fibroblasts that secrete growth factors and matrix regulatory proteins, which activate a fibrotic
Chi-Hao Chang et al.
Oncotarget, 6(3), 1478-1489 (2015-01-19)
Urothelial carcinoma is the most common type of malignancy in long-term dialysis patients and kidney transplant recipients in Taiwan. mTORCs (mammalian target of rapamycin complexes) and EGF are important in urothelial carcinoma. To identify the regulation of mTORCs upon EGF
Suman Mukhopadhyay et al.
Cell cycle (Georgetown, Tex.), 14(20), 3331-3339 (2015-09-01)
mTOR - the mammalian/mechanistic target of rapamycin - has been implicated as a key signaling node for promoting survival of cancer cells. However, clinical trials that have targeted mTOR with rapamycin or rapamycin analogs have had minimal impact. In spite
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.